Genetics and Human Origins

Introduction

There are two main views of Human origins. Biblical Creation or Darwinian Evolution. There are those that try to have it both ways but they are logically incomparable with each other. There are other views that exist but their proponents are few and they do not seem to be complete theories . Intelligent design while a useful tool, generally falls under the category of trying to have it both ways. Both Biblical Creation and Darwinian Evolution are fundamental concepts of history that produce ideas about Human origins. We will look at what both predict about human genetics and compare that to actual data to see which fits the facts the best.

Biblical Creation




Genesis Science Mission

Presentations

Articles

Book Store

Contact

About


Main

According to the Bible, was a special creation of God about 6,000 years ago without any common ancestor to any animals. That about 1600 years later there was a global flood that killed all but 8 people on the Ark. These survivors were Noah, his wife, his three sons, and their wives. It is from the three sons and their wives that all living human beings descended.

Biblical Creation predicts that while we should expect some genetic similarity with similar animals such as apes, there should still be considerable genetic differences. There should be a three-way split in our DNA with the starting point in the middle east. Actual mutation rates should point to a common human ancestor about 6,000 years ago or possibly the time of the Genesis Flood about 4400 years ago. There should be considerable variation within kinds of animals but no transitions between these kinds. A key test to two species being the same kind is interbred ability. Variation can result from natural adaptation, but there would be limits to how much variation can occur.

The DNA information system should be highly complex and in fact, be shown to be more and more complex as we learn more about it. It should be designed with a large degree of flexibility to allow organisms to adapt to different environments.


Darwinian Evolution

Living Cells

According to Darwinian Evolution, the apes are our closest relatives with chimpanzees being our closest relative of all. From all this, we can make several predictions about what we should find in our DNA. One prediction is that large sections of our DNA should be largely junk left over from the evolutionary process. Another prediction is that our DNA should be very similar to that of apes and chimps in particular. Two ape Chromosomes must have fused to form one of ours since apes have 24 pairs of chromosomes and humans have 23 pairs of chromosomes. Humans would not all be descended from one original couple but a group of humans that evolved from earlier forms. Modern human beings would have to have been around for at least hundreds of thousands of years but not for millions of years. The DNA information system should be as simple as possible with small changes in DNA not affecting much of the information content. Large portions of our DNA should be useless Evolutionary leftovers from past forms. Life would be infinity variable allowing all life on Earth to have evolved from a single cell ancestor. Natural Section must be a good enough filter of random munitions to add information to genomes over time.

Darwinian Evolution is not just the idea that life changes over time, creationists actually agree with this form of evolution. According to Darwinian Evolution not only did human beings have a common ancestor with apes but every living thing on the planet. This idea of universal common descent is a critical component of Darwinian Evolution. The simple fact is that according to Darwinian Evolution you are related to a banana and every other thing you eat. As a result according to Darwinian Evolution, we are all essentially cannibals eating our distant cousins every day, this is true even of vegetarians.

Cells are the basic building blocks of living organisms. An organism can be a single cell, or it can be made of billions of cells such as a human being. In Darwin's day, they only had optical microscopes under which cells looked like little more than bags of fluid. The result was that the notion that life could have arisen spontaneity (abiogenesis) seemed reasonable. Though Darwin's theory did not deal with the origin of life itself that origin is still an important part of the theory, because without that first cell there is nothing to evolve.

The fact is that living cells have such a high degree of organized complexity that abiogenesis can be shown to be thermodynamically impossible. This high degree of organized complexity includes several different types of organs that perform many different functions. The two types we will be looking at are the nucleus and mitochondria these contain a cell's DNA. The nucleus contains most of the DNA of a cell and this DNA we get equally from both parents. The mitochondria are the powerhouses of a cell, and they contain a relatively small portion of DNA that we only get from our mothers. This DNA has a lot to say about the origins of human beings.

The invention of the electron microscope showed that cells are far more complex than was ever imagined. This should have been the end of the notion of abiogenesis, but it was too important a part of Darwinian Evolution for it to be given up. Besides the alternative of creation by God had already been eliminated as a starting assumption making some form of abiogenesis necessary.



Deoxyribonucleic Acid 

Genes and DNA Sequences  

Deoxyribonucleic Acid known more commonly as DNA is the information storage system of living cells. This is more than a chemical system but a fully functional highly complex information system. The information it stores is not base on the chemistry of the DNA, but it is an arbitrary encoded information storage system. DNA forms a double helix consisting of Adenine, Thymine and Cytosine, Guanine pairs bound by a sugar-phosphate structure. The result is that there is no chemical favoring of any specific sequential arrangement of these pairs even allowing all four bases to be on both sides of the double helix. The result is that DNA could, in theory, be used to store any type of information someone would want to store in it. DNA is the densest information storage system known to exist with the information being encoded at the molecular level. It can store a whopping 1019 bits per cubic centimeter which 1000 time more than a flash drive at 1016 bits per cubit cementer. In fact, all the data in the world could be stored on 1 kg (2.2 pounds) of DNA.

In common use genes are units of heredity transferred from parent to offspring that determine some characteristic of that offspring. In technical usage, genes are often limited to DNA Sequences that encode instructions for making proteins. The differences between these two definitions can cause confusion since protein-encoding DNA make up only about 2% of our total DNA. As a result, some scientific discoveries have been used as pro-Darwinian Evolution propaganda that does not necessarily support it, since the speaker and listener can easily be thinking of different things from the word “gene”. 

A more accurate and up to date definition taking the results of the Encode project into consideration would be: "A gene is a unit of genomic sequences encoding a coherent set of potentially overlapping functional products."
 Reference: "What is a gene, post-ENCODE? History and updated definition."

This definition fits well enough with the common usage that it avoids the confusion of other definition, this is also the definition that will be used hereafter. DNA Sequences are generally printed out with the first letter of the encoding part of the nucleotide resulting in:

A for Adenine
T for Thymine
C for Cytosine

The result is that a print out of a DNA Sequence look something like this:

atgttaccgg ctgttggatc tgcggatgag gaggaggatc ctgcggagga ggattgtcct gaattggttc ccattgagac gacgcaaagc gaggaggagg aaaagtctgg cctcggcgcc aagatcccag tcacaattat caccgggtat ttaggtgctg ggaagacaac acttctgaac tatattttga cagagcaaca tagtaaaaga gtagcggtca ttttaaatga atttggggaa ggaagtgcgc tggagaaatc cttagctgtc agccaaggtg gagagctcta tgaagagtgg ctggaactta gaaacggttg cctctgctgt tcagtgaagg acagtggcct tagagctatt gagaatttga tgcaaaagaa ggggaaattt gattacatac tgttagagac cactggatta gcagaccctg gtgcagtggc ttctatgttt tgggttgatg ctgaattagg gagtgatatt tatcttgatg gtatcataac tattgtggat tcaaaatatg gattaaaaca tttaacagaa gagaaacctg atggccttat caatgaagct actagacaag ttgctttggc agatgccatt ctcattaata aaacagacct ggttccagaa gaagatgtaa agaaattaag aacgacaatt agatccataa atggactagg acaaatctta gaaacacaaa gatcaagttt gcagaaaaaa cttcagcatg tgccaggaac acaacctcac cttgatcaga gtattgttac aatcacattt gaagtaccag gaaatgcaaa ggaagaacat cttaatatgt ttattcagaa tctcctgtgg gaaaagaatg tgagaaacaa ggacaatcac tgcatggagg tcataaggct gaagggattg gtgtcaatca aagacaaatc acaacaagtg attgtccagg gtgtccatga gctctatgat ctggaggaga ctccagtgag ctggaaggat gacactgaga gaacaaatcg attggtcctc cttggcagaa atttagataa ggatatcctt aaacagctgt ttatagctac tgtgacagaa acagaaaagc agtggacaac acgtttccaa gaagatcaag tttgtacata  a

This is the actual HH772046 gene sequence for human beings


It is easy to think of the information stored in DNA as being stored in a simple linear fashion like the information on a tape. This is an overly simplified way of looking at it. In reality, the DNA information system is far more complex than that. It has overlapping genes with three-dimensional structuring to how the DNA and the information is stored in the Nucleus of a cell. In fact, the more it is studied the more complex the DNA information system proves to be.

Genes can be read at least three ways. They can be read in a single unit. They can be read in a segmented manner. The can even overlap each other Below are examples of each.

Epigenetics involves potentially heritable changes in gene expression without changes to the actual DNA sequence. These changes how cells read the genes resulting in a change in active and inactive genes. Epigenetic changes between types of cells tell a given cell what type (skin, heart, liver, and brain) of cell that cell is to be. When epigenetic changes go wrong they can cause many diseases including cancer. This is one of the reasons why it is an important area of study. It also adds yet another layer of complexity to the genetic information system what more do we have yet to discover. Each chromosome in a human cell is about a meter long strand of DNA and this DNA is rolled up with various proteins to form a chromosome. These proteins both rollup the DNA and serve as Epigenetic markers.

When epigenetic changes go wrong they often cause disease. These diseases include cancer leading to efforts to treat cancer by trying to reverse the flawed epigenetic changes rather than killing the cells. While epigenetic changes are passed on through cell division within an organism, most are erased during reproduction. However, some epigenetic changes are passed from parent to child. These epigenetic changes within a kind of animal allow for a lot of variety within that kind of animal. They result from environmental influences making it a useful tool for adaptation to different environments. Epigenetic changes seem to be a major factor in by changing what genetic information is used and how it is used. There are limits to the amount of change that can occur by this means since there is no change in genetic informational content. This is a problem for Darwinian Evolution which requires large amounts of new information. This shows that much of the changes actually observed in living things is not the new information needed by universal common descent.

Complexity of Genetic Information

How Natural Selection Really Works

atgttaccggctgttggatctgcggatgaggaggaggatcctgcggagga

atgttacc ggctgttggatctgcggatgaggaggaggatcctgcggagga

atgt taccggctgttggatctgcggatgaggaggaggatcctgcggagga

atgttaccggctgttggatctgcggat gaggaggaggatcctgcggagga
atgttac cggctgttggatctgcggatgaggaggaggatcctgcggagga
atgttaccggctgttggatctgcgga tgaggaggaggatcctgcggagga

Apollo put men on the Moon will be full tonight

Apollo put men on the Moon will be full tonight
Apollo put men on the Moon will be full tonight
Apollo put men on the Moon will be full tonight

When the harvest time comes all of it will happen

When the harvest time comes all of it will happen
When the time comes it will happen

National Institutes of Health [Public domain]


Darwinian Evolution is based on the idea that small variations in organisms being acted on by natural selection over time have produced all of the variety of life on Earth from a single common ancestor. One problem is that Darwin had no real idea as to what the source of those small variations is. The discovery of DNA has lead to the idea that mutations in the DNA sequence produce the changes and natural selection filters out the duds while supporting the beneficial changes. Natural selection is often compared to the artificial section used by humans in breeding animals but these processes are not the same. Artificial section is the deliberate choosing of particular traits that are desirable to those making the selection, furthermore, the selected traits are often not beneficial to the animals. Natural selection, on the other hand, does no real choosing of traits and in fact, does not focus on specific traits with its only real goal being survival meaning that at best it just filters out bad mutations.

This is how Evolutionists often imply the effects of mutations are distributed. Even when they admit that most mutations are at least a little harmful it is always implied that a reasonable percentage is beneficial. One trick is to insist that a mutation is beneficial when it produces an environment specific benefit that is generally harmful to the organism.            

Their theory would work best if the effects of mutations nearly followed a bell curve with a narrow range of low selective pressure in the middle. If it were real this would provide a strong enough selection that Evolution might have a chance. However, it is not real and not even close to being real.

The reality is that most mutations are slightly harmful. As mutations get more and more harmful the numbers get smaller an smaller. There may be an extremity few slightly truly beneficial mutations. The problem is that the extremity few slightly truly beneficial mutations are too small to have any selective pressure. The majority of selection is against the relatively few highly harmful mutations and the accumulation of many smaller ones.

Image from: Genetic Emtropy and the Mystory
of the Genome by Fr. J.C. Stamford

Image from: Genetic Emtropy and the Mystory
of the Genome by Fr. J.C. Stamford

Image from: Genetic Emtropy and the Mystory
of the Genome by Fr. J.C. Stamford

Image from: Genetic Emtropy and the Mystory
of the Genome by Fr. J.C. Stamford

The result is the Natural Selection serves mainly as a conservative filter filtering out the really bad deadly mutations. It also does allow mutations that have some environmental benefit to be passed on even though that mutation is generally harmful. Such mutations result from a loss of specialization. Making the organism generally weaker than the non-mutant, but the mutation just happens to allow the mutant to survive an unusual situation.

A good example of a generally less fit organism having a survival advantage under special conditions can be illustrated with wolves and chihuahuas. Lock a dozen wolves, and chihuahuas in a room, give them water but no food. In a week you will only have wolves because they would have eaten the chihuahuas. Now let's redo this experiment by mounting a bunch of remote-controlled machine guns around the room at about 2 feet high. Within seconds of turning on the guns, the only living dogs in the room will be the chihuahuas. All the wolves would have been shot.

In reality, Natural Selection boils down to a conservative filter that allows some mutations to aid in adaptation at the expense of the general fitness of the organism and a loss of genetic information. Natural Selection also works on epigenetic changes resulting in what are often reversible adaptations to environmental changes where the actual genetic information is conserved.



Mitochondrial Eve

Comparing Human and Chimpanzee Genomes

So Called Junk DNA

You have probably heard the claim that Human DNA is 98% or even 99 % similar to that of a chimpanzee. These figures are often quoted without explaining how the two genomes were actually compared. The fact is that this claim is more propaganda than science, while the figures are based on a scientific comparison, it is not the entire story even from the actual study on which it is based.

Part of our DNA encodes for proteins but most of it does not. Not knowing what this non-encoding DNA does Evolutionists assumed based on Darwinian Evolution that it was useless junk left over from the Evolutionary process. As a result, this non-encoding DNA has been labeled Junk DNA by Evolutionists in typical propaganda style. However, a research project called Encode has shown that most and probably all of this so-called Junk DNA have a function. Most this functionality involves regulating the protein-encoding genes and similar functions. Junk DNA is nothing more than Evolutionary propaganda, It is not junk but important fully functional DNA.

Despite the fact that these drawings are highly biased towards similarity, they still show enough differences to show that the claim of 98-99% similarity between human and chimpanzee DNA is a myth. Depictions such as these are often used to show the alleged similarity between humans and apes and particularly chimpanzees making them great pro-evolution propaganda tools. The fact that these drawings are highly biased towards similarity is evident when you look are the actual images of the chromosomes.

Hand drawings comparing the DNA of Humans to that of the great apes from Chromosome Comparisons

Hand photographic comparing the DNA of Humans to that of the great apes from the article "This Picture Has Creationists Terrified"

Ironically the article that the above picture is from is called "This Picture Has Creationists Terrified." I for one am not terrified, but it is actually quite helpful to a creationist perspective. Despite actually being described as pictorial evidence of the similarity between Human, chimpanzee, gorilla, and orangutan chromosomes, this set of chromosome images shows considerable differences. This picture further shows the claim Human, and chimpanzee DNA is 98 - 99% similar to be false and nothing more than propaganda. However, despite the clear differences shown by these visual depictions, it is the actual numerical count of differences that busts the 98 - 99% similarity myth wide open.

The comparing of human and chimpanzee DNA that yields the 98-99% figure (the actual figure is 98.77%.) is not a result starting at one end of each chromosome and tabulating the nucleotides that match and do not match. Doing that would produce an embarrassingly low figure with no propaganda value. To get the 98.77% figure they actually have to ignore a significant portion of both genomes. What they do is enter a segment of one genome into a computer program that finds the segment most easily aligned with it in the other. They then only count the substitutions which are places where one nucleotide is swapped for another and not indels which are one or more nucleotide that found in one and not the other. 

When the indels are added there is an additional 3% worth of differences resulting in a similarity of 95.89% in these easily aligned sections. To get the real amount of similarity it is necessary to include those portions that cannot be aligned. The most accurate method would be to take the percentage of easily aligned sections within each chromosome and apply the percent similarity to it and then average the percentage of all the chromosome to get the actual percent similarity of the two genomes

atgttacaggctgtcggatc-----atgaggaggatgatcctgcggagga
atgttaccggctgttggatctgcggatgaggaggacga-----cggagga

In their drawings of the patterns of human chromosome 2 and the three great apes chromosomes 2a and 2b (labeled by evolutionists) they are made to look so similar that they seem to prove the fusion theory. These drawings make such good propaganda that if this was all you were given you would be convinced not only of human chromosome 2 fusion theory but that we must have a common ancestor with chimpanzees other apes.

Before we go on I have to make this fact clear and that is that human chromosome 2 fusion theory even if proven true would not prove we have a common ancestor with apes. It is quite possible that the original humans (Adam and Eve) were created with 24 pairs of chromosomes, and a subsequent fusion event occurred reducing it to 23. Biblically this could have happened at the fall or any time before Noah's Flood so if human chromosome 2 fusion theory were proven it would have no effect on Biblical Creation. Evolutionists, but, need human chromosome 2 fusion theory to be true because their entire world view requires it. Evolutionists will use any scrap of data they can find to try to support it and they will ignore and dismiss any evidence that goes against it. Since Evolutionists need human chromosome 2 fusion and Creationists have no problem if it is true, Creationists can be totally objective on the topic, while Evolutionists desperately need it and cannot be even remotely objective.

However when you look at actual images of the chromosomes the similarity all but disappears. True there are some similarities in the patters but the chimp chromosome 2b has a segment not found in human chromosome 2 right near the alleged fusion point and on the wrong side of it. Further more this is just the tip of the genetic ice burg that goes against human chromosome 2 fusion theory.

One of the many genetic differences between humans and apes is that all of the apes have 24 pairs of chromosomes while humans have only 23. As a result, in order for humans to have a common ancestor with two smaller ape chromosomes would have to fuse to form our chromosome 2. As result Evolutionists are desperate to try to prove human chromosome 2 fusion theory because, without it, their entire world view collapses.

This results in an actual percent similarity between human and chimpanzee genomes of 67.1%, this is a far cry from the 98.77% similarity quoted by Evolutionists. The 32.9% actual difference totally destroys the notion of that human and chimpanzee had a common ancestor. So why do Evolutionists keeping quoting the 98.77% figure? One reason is ignorance, that is that they have heard the 98.77% figure as true without really knowing where it comes from. The other is that the 98.77% figure makes great propaganda and when you have the courts keeping alternative views out of public shoos they have no one to challenge such claims. The fact is that human and chimpanzee genomes are only 67.1% similar, not 98.77% as claimed by Evolutionists. 

Totally Busted

The myth that human and chimpanzee DNA is 98-99% similar is once and for all 

Human Chromosome 2 Fusion Theory 


The main evidence claimed for human chromosome 2 fusion theory are the alleged fusion site, and an alleged inactive centromere that would coincide the centromere on ape chromosome 2b. While the claim of an inactive centromere is made, it has not been possible to find a copy of the actual nucleotide sequence. There is far more information on the alleged fusion site, and it actually yields problems for human chromosome 2 fusion theory. As stated earlier, the actual nucleotide sequence of the alleged inactive centromere is not available making a personal study of the site impossible. However, an inactive centromere would contain a set of highly variable repetitive sequences called alpha-satellite DNA or alphoid DNA for short. The fact that alpha-satellite DNA is highly variable is likely the reason it is hard to find since it makes poor propaganda. While this alphoid DNA is found in centromeres, they are not unique to centromeres. Also, the alleged centromere is way too small and while some of the alphoid DNA does get deleted in an inactive centromere it is not enough to account for the small size. The simple fact is that the evidence for a second remnant centromere at any stage of sequence degeneracy is negligible and nowhere near enough to objectively say it is an inactive centromere. Furthermore, alphoid DNA is not unique to centromeres but are found elsewhere in both human and chimpanzee genomes. They do not necessarily occur in the same places in human and chimpanzee genomes. They are more plentiful in the human genome.

From Debunking the Debunkers by Jeffrey P. Tomkins

From by Jeffrey P. Tomkins

BLASTN hits for 171 base consensus alphoid repeat on human

BLASTN hits for 171 base consensus alphoid repeat on human

BLASTN results from querying the 171 base human consensus alphoid sequence (accession X07685)
against both the (a) human and (b) chimpanzee (PanTro4) genomes using gap extension and no repeat masking.

From Debunking the Debunkers by Jeffrey P. Tomkins

As you can see, the human chromosome 2 has far more alphoid sequences then chimpanzee chromosome 2A and 2B combined. The above illustration shows but the human chromosome 2 is not a match to what it should be if we had a common ancestor with chimpanzees.

This is the actual sequence of the alleged chromosome fusion site a human chromosome number two. A telomere is essentially a DNA end cap with a repetitive sequence of TTAGGG. These end caps are usually 10s of thousands of base pairs long, but the alleged fusion site is only hundreds of base pairs. However, since the shortening of the end caps tends to promote fusion, this may not be a problem. If this were a head to head fusion, we would expect to see repeats of TTAGGG and the reverse sequence CCCTAA on opposite sides of the fusion site. It should also include may repeats of the alternatives TCAGGG, , CCCTGA and on their respective sides. These repeat sequences should be clumped together on both sides of the fusion site.

If this really was a fusion site, this is how it actually looks. Note to the sequence that is on the wrong side of the alleged site.If this really was a fusion site, this is how we would expect it to look. Going only on the basis of sequences there is enough similarity to a telomere that if one wants to consider this a fusion site you can see it that way. However, the site is enough, unlike a telomere that it cannot be objectively or conclusively considered a telomere fusion site. Remember Evolutionists need this to be a telomere fusion site, or their theory is done for. There are good reasons to why this is probably not a telomere fusion site. These sequences are not unique to telomeres but occur in several places in the Human genome. Among these are, gene transcription factor binding sites. In Human beings, the area around the alleged fusion site contains a number of genes not found in chimpanzees. The 3 Exon variant of the DDX11L2 gene which produces an important non-encoding RNA crosses the alleged fusion site. The DDX11L2 gene was originally labeled a pseudogene that was thought by Evolutionists to not have a function but the Encode project found that it is not only functional but regulates the DDX11 gene which codes for the important DDX11 protein.

From Debunking the Debunkers by Jeffrey P. Tomkins

This fact strongly shows that this is not a fusion site. Particularly the fact that, one of the gene's transcription factor binding sites is inside the alleged fusion site since it shows that the alleged fusion site is an active segment of DNA. One final fact to note is that when the actual sequences of Human chromosome 2 and chimpanzee chromosome 2a and 2b are compared including the unalignable DNA they are only 66.2% similar and the alleged fusion site is part of the unalignable DNA.

The Bible clearly states that all mankind is descended from one man and woman; Adam and Eve. In recent years genetic studies have shown this to be the case. One interesting outcome of these studies is support for the fact that our most recent female ancestor (Eve) is actually older than our most recent common male ancestor. (Noah) Of the two lines of study, the one pointing to Eve is the most interesting. This provides compelling evidence for Biblical history. It also stands as an example, of how evolutionary interpretation actually obscures evidence in support of the Biblical account. It also shows the lengths evolutionists will go to, to dismiss such evidence.




From How to protect cells from selfish mitochondrial DNA in phys.org 

In 1987, a team at the University of California at Berkeley compared the mitochondrial DNA (mtDNA) of several groups of people from different geographic locations. They concluded that all of these people had the same female ancestor and called her "Mitochondrial Eve." They then proceeded to calculate the mutation rate based on such evolutionary assumptions as the time of our alleged divergence from a supposed common ancestor with chimps. 

Max Ingman et al, Nature 408, 708 - 713, Mitochondrial genome variation and the origin of modern humans (published in 2000)

From the mean genetic distance between all the humans and the one chimpanzee sequence (0.17 substitutions per site) and the assumption, based on paleontologist and genetic evidence, of a divergence time between humans and chimpanzees of 5 Myr, the mutation rate for the mitochondrial molecule, excluding the D-loop, is estimated to be 1.70 X 10-8 substitutions per site per year.

They concluded based on this estimated mutation rate that Mitochondrial Eve lived 100,000 - 200,000 years ago.

In 1997 a paper entitled A High Observed Substitution Rate in the Human Mitochondrial DNA Control Region by Parsons, Thomas J., et al. was published in Nature Genetics. They compared the mt-DNA of many mother-child pairs and found that mutations in mtDNA occur about 20 times more rapidly than previously thought. Based on these measurements they calculated Mitochondrial Eve lived only about 6,500 years ago. This is about the time the Bible gives for when the real Eve lived. Further research has been done in this area, and they are quite interesting. Parsons later combined his research with others (calibrating the Mitochondrial Clock) resulting in a figure of 1 motion per 1,200 years which is 1/10 the evolutionary estimate and 1.5 times Parsons original figure for an estimated date of mitochondrial Eve of 10,000 years which is still in the general ballpark of the Biblical account.

The only real reason these figures are rejected is that it agrees with the Bible while being contrary to evolution. Now it is possible, that mitochondrial Eve is not actually Eve herself but one of her female descendants. She would be the last common ancestor of Noah's three sons’ wives. Eve could have been the last common ancestor of these three women but that ancestor could have been one of Eve's pre-Flood female descendants. The difference between the Biblical figure and the approximate figure of 10,000 years only requires a slightly elevated mutation rate at some time in the past.

DNA and Babel 

Conclusion


aThe Genographic Project is a project started by, the National Geographic Society, IBM, geneticist Spencer Wells, and the Waitt Family Foundation. The idea is to determine the migration patterns starting in Africa and going to the rest of the world. The conclusions are based largely on the assumption of Evolution. They show it starting in Namibia, in Africa, based entirely on an Evolutionary interpretation of the fossil record. This Evolutionary interpretation of the data also influences the migration atlas and genetic relation graphs. Despite this fact, the data as presented by National Geographic still shows indications of the post Babel dispersion as mentioned in the Bible. 

The apparent trends showing a migration from Namibia are 100% interpretation. The raw data in this study is a bunch of Mitochondrial and Y-chromosome DNA samples from various parts of the world. We get mitochondrial DNA only from our mother and Y-chromosome DNA only from our father. From this data, it is possible to show which lines are more closely related to which. However, projecting back to an origin requires making assumptions about where that origin was. Those who did this study made the evolutionary assumption that the origin was in Namibia, however, one can also make the Biblical assumption that it started in Iraq. Both are arbitrary assumptions, and they produce different directions in some of the migration trends. Unfortunately, the public is not told about the assumptions made in these studies. In fact, the Evolutionists that did it probably do not realize that starting in Namibia is an arbitrary assumption. 

This interpretation is supported by their own family trees of both Mitochondrial and Y-chromosome lines. This is particularly evident in the Y-chromosome line where M89 (the one in Iraq) has about twice as many offshoots as the other lines combined. A similar pattern can be seen in the Mitochondrial line. In both cases, if you place the ancestor marker in Iraq, the distribution of decedents is more even than if you place it in Africa. One other thing about this data that supports the Bible is that there is a clear 3 way split in both and the Mitochondrial and Y-chromosome lines when one starts in Iraq. Now, Noah had 3 sons and 3 daughters-in-law. Since the Bible does not indicate that Noah and his wife had any kids after the Flood, we would expect a 3-way spit, and that is what we have.

This Mitochondria family tree is derived from the one at National Geographic. This one is based on the Biblical starting point in Iraq, while theirs is based on the Evolutionary starting point in Namibia.

This Y-chromosome family tree is derived from the one at National Geographic but this one is based on the Biblical starting point in Iraq, while theirs is based on the Evolutionary starting point in Namibia.

This chart takes National Geographic's relationships and migration routes at face value. They are distorted somewhat by the Evolutionary assumptions in National Geographic's cart and map. However, despite this, the influence of Evolution the 3 way split from Noah's 3 daughters-in-law is clearly seen when one starts in Iraq. It is also possible based on both map and family tree data to show with a fair degree of probability which line came from which daughters-in-law. Is also indicates that Mrs. Shem and Mrs. Japheth were more closely related to each other than they were to Mrs. Ham. 

However, despite the influence of Evolution the 3 way split from Noah's 3 sons is clearly seen when one starts in Iraq. It is also possible based on both map and family tree data to show with a fair degree of probability which line came from which son. The result is that even though this data as presented by National Geographic is loaded with evolutionary assumptions, it still shows patterns consistent with the Biblical account. Most likely if all of the Evolutionary assumptions in this map could be stripped away, it would probably show patterns even more consistent with the Bible.

The simple fact is that despite all the hype from Evolutionists, genetic evidence does not support the idea that we had a common ancestor with Chimpanzees or any of the great apes. The claims of evidence are based mainly on Evolutionary assumptions and not objective science. The complexity of genetic information is beyond what could be expected by way of natural processes and chance.

Natural Selection is simply not a good enough filter to do the job required by Darwinian Evolution, lacking the needed spesitivity to produce any form of new information from random mutations. The comparison of human and chimpanzee genomes and the reporting of results suffers much from Evolutionary presupposition, with much of the reporting being largely propaganda. The reality is that human and chimpanzee genomes are not 98-99% similar as is often claimed but only 67.1% similar which is a huge difference.

Not only is human chromosome 2 fusion theory not objectivity supported by the evidence, but the presence of an important gene at the alleged fusion site kills the claim. Both mitochondrial and Y-chromosome DNA support for all human beings as the Bible says while supporting the Biblical accounts of the Flood and the Tower of Babel.

When taken as a whole apart from Evolutionary assumptions and propaganda, genetic data does not support Darwinian Evolution but actually supports Biblical Creation. This genetic data shows we were created by God and did not have a common ancestor with any plants or animals.